Evaluation of Selected Tomato Cultivars Effectiveness Against Tomato Yellow Leaf Curl Virus (TYLCV) and Its PCR-Based Molecular Detection

Viral diseases are the primary impediment to tomato cultivation. One of the most destructive viral diseases is Tomato yellow leaf curl virus (TYLCV) transmitted by the insect vector whitefly. A research study was undertaken utilizing RCBD design to evaluate the varietal performance of tomato against TYLCV at Sher-e-Bangla Agricultural University, Dhaka. Genomic DNA extraction and PCR tests were executed in laboratory conditions to detect TYLCV. In this study, ten tomato cultivars namely BARI Tomato-5, BARI Tomato-8, BARI Tomato-9, BARI Tomato-11, BARI Tomato-14, BARI Tomato-15, BARI Tomato-16, BARI Tomato-17, BARI Tomato-18 and BARI Tomato-19 were selected to carry out the research. Among the cultivars, BARI Tomato-5 showed the lowest disease incidence (19%), disease severity (29.5%) and whitefly association (16.5) preceded by BARI Tomato-18 and BARI Tomato-19 at 60 DAT. Whereas, BARI Tomato-16 showed the maximum disease incidence (91%), disease severity (59%), and whitefly association (52) at 60 DAT. In case of morphological parameters, the maximum number of leaves (68.2), branches (10.34), flowers (182.76) were found in BARI Tomato-5 and the minimal quantity of leaves (44.68), branches (4.43), flowers (44.93) were found in BARI Tomato-16. In case of yield and yield contributing parameters, the maximum number of fruit diameter (6.66 cm), individual fruit weight (181.30 g), yield (4.10 kg) was found in BARI Tomato-5 and the minimal quantity of fruits (2.08 cm), individual fruit weight (37.13 g), yield (1.05 kg) was found in BARI Tomato-16. From the molecular study, seven highly susceptible varieties viz. BARI Tomato-8, BARI Tomato-9, BARI Tomato-11, BARI Tomato-14, BARI Tomato-15, BARI Tomato-16, BARI Tomato-17 were given positive results in the PCR test and showed the sharp band at 520 bp fragment. However, considering the field performance and molecular detection, it may be concluded that among the tested cultivars, BARI Tomato-5, BARI Tomato-18, and BARI Tomato-19 can be used as a resistant or moderately resistant cultivars against TYLCV.

Introduction

A solanaceous horticultural cultivar that self-pollinates is the tomato. It is frequently considered the most popular food item and is a vital part of a wide variety of raw, cooked, and processed foods [1]. In 2022, global tomato production was around 186.82 million tons from a total area of 5 million hectares, with an average yield of 36.97 tons per hectare [2]. Due to the high adaptability, it is widely grown in Bangladesh. In 2022–2023, Bangladesh produced over 469204.49 metric tons of tomatoes on 76943.14 acres of land, with an average yield of 6098.07 kg/acre throughout the winter [3]. Brightly colored, tomatoes are rich in a number of nutrients [4]. A nutrient-dense powerhouse, tomatoes provide a multitude of crucial vitamins and minerals that are important for good health [5]. It has high levels of lycopene, carotenoids, and polyphenolic chemicals, which lower the risk of prostate cancer and are potent antioxidants [6]. Despite this, the prevalence and financial consequences of infections from viruses in tomatoes vary widely based on a number of variables, including the virus itself, cropping system, and climate. Tomato crops are particularly vulnerable to viral infections, which drastically reduce both yield and quality [7]. In Bangladesh, twenty-two distinct tomato viruses were found [8]. Considering diseases caused by viruses TYLCV, or Tomato yellow leaf curl virus, is among the most destructive and reduce yield up to 100% [9]. A group of viruses from the family Geminiviridae, genus Begomovirus, comprising at least 13 species, are responsible for the disease [10]. Whiteflies (Bemisia tabaci) are the persistent and circulative vectors of TYLCV transmission and regarded as a highly damaging insect pest [11], [12]. Tomato plants that have TYLCV exhibit symptoms such as decreased leaf size, upward curling of the leaves, severe stunting, and deformation linked to interveinal chlorosis, which are primarily seen on the upper part of the plants [13]. The disease has been managed using a variety of tactics, all of which have failed. However, plant viral infections can be quickly diagnosed using a variety of technologies, including big data-based methods, isothermal methods and serological systems [14]. Among these methods, the polymerase chain reaction (PCR) provides sensitivity and specificity for identifying and detecting viruses spread by whiteflies in affected plants [15]. So, the purpose of this study was to assess the studied tomato cultivars’ resistance to the Tomato Yellow Leaf Curl Virus (TYLCV) and to identify TYLCV using a contemporary molecular technique called PCR.

Materials and Methods

Experimental Location

This research was successfully conducted out throughout the winter months in both field and lab settings.

Planting Material

The selected tomato cultivars were collected predominantly from the Bangladesh Agricultural Research Institute (BARI) and used in this study were: BARI Tomato-5, BARI Tomato-8, BARI Tomato-9, BARI Tomato-11, BARI Tomato-14, BARI Tomato-15, BARI Tomato-16, BARI Tomato-17, BARI Tomato-18 and BARI Tomato-19.

Experimental Design

Each variety has three plots, and the experiment was conducted using a Randomized Complete Block Design (RCBD) with three replications. There were 30-unit plots in total.

Field Arrangements and Seedling Transplantation

A power tiller was used to plough the chosen plot multiple times, and it was leveled to achieve an ideal shape. Seedlings that were 30 days old were relocated into the pits of the experimental plots, maintaining a 40–60 cm separation between the lines and plants, respectively.

Visual detection of Tomato Yellow Leaf Curl Virus (TYLCV)

The characteristic symptoms of TYLCV infection, such as cupping, curling, peripheral chlorosis, whirling, as well as stunted growth of plant, were observed on naked eye [16].

Estimation of Disease Incidence and Severity

Disease incidence was estimated by using the following formula [17], [18]:

$$\begin{array}{rl}Diseaseincidence(\mathrm{\%})& =\frac{Numberofdiseasedplant}{Numberoftotalplantsobserved}\\ & \times 100\end{array}$$

Following that, the disease rating scale “0–6” was used to calculate the disease prevalence reactivity [19].

The symptom severity scale “0–4” outlined by [20] was used to assess the onset of symptoms. The disease’s severity was calculated using the formula below [21]:

$$\begin{array}{rcl}& & DiseaseSeverity(\mathrm{\%})=\\ & & \frac{Sumtotalofdiseaserating\times 100}{Sumofoverallobservation\times highestgradeinthescale}\end{array}$$

Inspection of Insect Vectors (whitefly) Association

The yellow trap approach was used to examine the whitefly association in this study. Yellow board measuring six by six inches and polished with sticky oil was utilized.

Molecular Detection of TYLCV through PCR

Using total DNA as a template, the PCR test was conducted to identify the TYLCV after total genomic DNA was first isolated.

Primer Designing

Utilizing the primer-3 version 0.4.0 software, Coat-protein (CP) gene specific primers were developed for TYLCV detection [22]. The primer pair utilized in the investigation is shown in Table I and was produced commercially.

Table I. Detailed Characters of Primer Pair with their Sequencing

Primers	Primer sequences 5′-3′	Tm of primers (°C)	Amplicon size (bp)
TYLCV 520-FP	TAATATTACCGGACCGC	55	520
TYLCV 520-RP	TGGAGCTTGCAAGGCCCTTCACA	55

Components of DNA Extraction Kit

GF-1 plant DNA extraction kit was used and the components of this kit are shown in Table II.

Table II. Components of GF-1 DNA Extraction Kit

Components	Amounts
GF-1 columns	50
Collection tubes	50
Plant tissue lysis buffer (Buffer PL)	18 ml
Plant genomic binding buffer (Buffer PB)	35 ml
Wash buffer	24 ml
Elution buffer	10 ml
Proteinase	1.05 ml

DNA Extraction and Genomic DNA Analysis

Total DNA was extracted using nucleic acid extraction kit (GF-1 kit) according to the manufacturing standard protocol from tomato leaves. The extracted genomic DNA was analyzed in 1% agarose gel and stored at −20°C (Fig. 1).

Fig. 1. Analysis of genomic DNA in 1% agarose gel.

PCR Amplification

Using PCR amplification, the existence of TYLCV was identified. PCR amplification and PCR process was done according to the manufacturing standard protocol.

Electrophoresis and Documentation of Agarose Gel

A 1% (w/v) agarose gel was used to electrophorese PCR products. These were treated with 0.5 mL of ethidium bromide and examined using a UV transilluminator and a gel documentation system. The results were examined in comparison to the Vivantis DNA marker.

Counting of Morphological Parameters of Tomato

The number of leaves, branches and flowers of each tagged plants were totaled from 30 days after transplanting and continued up to 60 days after transplanting (DAT).

Measurement of Yield Attributes of Tomato

Average tomato fruit weight (g), diameter (cm) for each plant according to variety as well as total yield (kg) per plant were measured by using slide calipers and digital weight balance.

Statistical Analysis of Data

The most recent version of the "Statistix-10" software was used to analyze the data. The LSD range test was used to compare the mean value at the 5% level of significance.

Results and Discussion

Disease Intensity Levels and Varietal Susceptibility against Tomato Yellow Leaf Curl Virus (TYLCV) in Particular Tomato Cultivars

During the study period, significant variations of disease intensity levels of TYLCV were observed in particular tomato cultivars. In terms of disease incidence (%), T₆ cultivar had the highest disease incidence (79%, 89%, and 91% at 30 DAT, 45 DAT, and 60 DAT, respectively), followed by T₅, T₂, and T₁₀ cultivars. Among the varieties, the moderate disease incidence (73%, 77%, and 81.5% at 30 DAT, 45 DAT, and 60 DAT) was found in T₇ cultivar followed by T₃ and T₄ cultivars. On the other hand, the lowest disease incidence (14%, 15.5%, and 19% at 30 DAT, 45 DAT, and 60 DAT, respectively) was recorded in T₁ cultivar preceded by T₈ (15.5%, 19%, and 21% at 30 DAT, 45 DAT, and 60 DAT) and T₉ (18%, 22.5%, and 23.5% at 30 DAT, 45 DAT, and 60 DAT) cultivars. These findings are corroborated by previous studies of Reddy et al. [23] and Zeshan et al. [24], where it was observed that the disease incidence ranged from 4% to 100% in winter and from 60% to 100% in the summer months.

In case of disease severity (%), the lowest disease severity (11%, 18.5%, and 29.5% at 30 DAT, 45 DAT, and 60 DAT respectively) was recorded in T₁ cultivar preceded by T₈ (14%, 21.5%, and 33% at 30 DAT, 45 DAT, and 60 DAT) and T₉ (16.5%, 24% & 35.5% at 30, 45 and 60 DAT) cultivars. Among the cultivars, the moderate disease severity (22%, 33%, and 47% at 30 DAT, 45 DAT, and 60 DAT) was found in T₇ cultivar followed by T₃ and T₄ cultivars. On the other hand, the highest disease severity (31%, 43%, and 59% at 30 DAT, 45 DAT, and 60 DAT respectively) was recorded in T₆ cultivar followed by T₅, T₂ and T₁₀ cultivars. These outcomes were comparable to the findings of Yadav and Awasthi [25]. The disease intensity levels were found higher in BARI Tomato-16 due to the maximum density of whitefly populations, lower resistance capability and lower in BARI Tomato-5 due its higher resistance capability against the TYLCV disease. Almost similar results were observed by Anco et al. [26] that TYLCV incidence seems to positively correlate with increasing densities of whiteflies.

From the analysis of disease intensity level, seven cultivars (T₆, T₅, T₂, T₁₀, T₇, T₃, and T₄) were moderately or highly susceptible and three cultivars (T₁, T₈, T₉) were resistant or moderately resistant to TYLCV (Table III). These findings are consistent with those of Ali et al. [19] and Rashid et al. [27].

Table III. Varietal Resistance, Disease Incidence, and Severity Percentages against TYLCV in Particular Tomato Cultivars

Cultivars	Disease incidence (%)			Disease severity (%)			Level ofresistance/susceptibility
	30 DAT	45 DAT	60 DAT	30 DAT	45 DAT	60 DAT
T1: BARI Tomato-5	14 i	15.5 j	19 h	11 j	18.5 j	29.5 j	Resistant/moderately resistant
T2: BARI Tomato-8	75.5 c	81.5 c	87 b	28 c	36.5 c	52 c	Susceptible/highly susceptible
T3: BARI Tomato-9	72 ef	74 f	80.5 d	20.33 f	29.5 f	41.5 f	Susceptible/highly susceptible
T4: BARI Tomato-11	71 f	72 g	75 e	18.5 g	27.5 g	39.5 g	Moderately/highly susceptible
T5: BARI Tomato-14	77.5 b	85.5 b	88.5 b	29.5 b	39.5 b	54 b	Susceptible/highly susceptible
T6: BARI Tomato-16	79 a	89 a	91 a	31 a	43 a	59 a	Susceptible/highly susceptible
T7: BARI Tomato-17	73 de	77 e	81.5 d	22 e	33 e	47 e	Susceptible/highly susceptible
T8: BARI Tomato-18	15.5 h	19 i	21 g	14 i	21.5 i	33 i	Resistant/moderately resistant
T9: BARI Tomato-19	18 g	22.5 h	23.5 f	16.5 h	24 h	35.5 h	Resistant/moderately resistant
T10: BARI Tomato-15	74 d	78.5 d	83.5 c	25 d	34.5 d	50 d	Susceptible/highly susceptible
CV (%)	1.13	0.94	1.38	3.44	1.85	1.10
LSD value (0.05)	1.1036	0.9945	1.5370	1.2754	0.9737	0.8286

Detection of TYLCV through PCR

Following the optimized procedure for PCR amplification, the PCR product samples were placed onto a 1.5% agarose gel. Two sides of each specimen retrieved from ten tomato cultivars were separated by a 100 bp DNA ladder into it. The gel analysis revealed that samples from seven different kinds—T₂, T₃, T₄, T₅, T₁₀, T₆, and T₇—had positive PCR findings and showed a strong band at 520 bp, making it clear that the virus was detected in each of the seven cultivars. The absence of bands in the gel evidence, however, suggests that the specimens from the three varieties—T₁, T₈, and T₉—were not amplifying and produced negative PCR test findings (Fig. 2). In these three tomato varieties, infection was present, but viral genome expression was absent. So, it was inferred that despite the cultivars’ infection, they exhibited a moderate level of resistance to TYLCV. These findings were supported by Samarakoon et al. [28] and Briddon and Markham [29], where they found that PCR methods work very well as a tool for quickly and extensively diagnosing TYLCV-infected samples. The presence of TYLCV was further verified using the polymerase chain reaction (PCR), as explained by Srinivasan et al. [30].

Fig. 2. PCR amplification for detecting tomato yellow leaf curl virus (TYLCV) Note: T₁: BARI Tomato-5, T₂: BARI Tomato-8, T₃: BARI Tomato-9, T₄: BARI Tomato-11, T₅: BARI Tomato-14, T₆: BARI Tomato-16, T₇: BARI Tomato-17, T₈: BARI Tomato-18, T₉: BARI Tomato-19, T₁₀: BARI Tomato-15.

Incidence of Whiteflies Per Plot in Selected Tomato Varieties at 30, 45, and 60 DAT

Significant variation was noted in the whitefly association at different days after transplanting (DAT). Throughout the crop duration, the highest number of whitefly association (37, 45, and 52 at 30 DAT, 45 DAT, and 60 DAT, respectively) was recorded in T₆ cultivar followed by T₅, T_2, and T₁₀ cultivars. Among the cultivars, the moderate number of whitefly association (28, 30, and 35 at 30 DAT, 45 DAT, and 60 DAT) was found in T₇ cultivar followed by T₃ and T₄ cultivars. The lowest number of whitefly association (13.83, 13, and 16.5 at 30 DAT, 45 DAT, and 60 DAT, respectively) was recorded in T₁ cultivar preceded byT₈ and T₉ cultivars. The frequency of whitefly associations was shown to increase as plant age rose (Fig. 3). KAWSER MD [31] and Gupta ND [32] observed the nearly identical relationship between whiteflies and TYLCV infection.

Fig. 3. Number of whiteflies in different growth stages of tomato cultivars at 30 DAT, 45 DAT, and 60 DAT.

Morphological Parameters and Yield Attributes of Tomato Varieties against TYLCV Disease

Quantity of Healthy Leaves, Branches and Flowers on Each Plant of Specific Tomato Cultivars

Among all the cultivars, T₁ cultivar had the healthiest leaves (68.2), whereas T₆ cultivar had the fewest (46.68). Although, T₁ cultivar had the most branches in each crop (10.34), despite T₆ cultivar having the fewest (4.43). While T₆ cultivar produced the fewest flowers (44.93), T₁ cultivar produced the most (182.76). These parameters were decreased with the increasing intensity of TYLCV (Table IV). Almost alike results were observed by Hossain et al. [33], where they reported that the reduction of number of leaves, branches, flowers due to TYLCV were 36.99%–53.96%, 29.10%–59.66% and 44.95%–56.50%, respectively.

Table IV. Efficacy of TYLCV Disease on Morphological, Yield and Production Causative Traits in Tested Tomato Varieties

Cultivars	Number of healthy leaves/plant	Number of branches/plant	Number of flowers/plant	Fruits diameter (cm)	Individual fruit weight (g)	Yield (kg)/plant
T1: BARI Tomato-5	68.2 a	10.34 a	182.76 a	6.66 a	181.30 a	4.10 a
T2: BARI Tomato-8	47.98 h	5.08 ef	46.71 h	4.56 ef	56.58 h	1.64 g
T3: BARI Tomato-9	53.2 e	6.85 cd	60.25 e	5.50 cd	75.11 e	2.25 e
T4: BARI Tomato-11	54.46 d	7.38 c	61.10 d	6.05 bc	85.25 d	2.50 d
T5: BARI Tomato-14	46.86 i	4.75 ef	46.30 h	4.23 f	40.61 i	1.15 h
T6: BARI Tomato-16	44.68 j	4.43 f	44.93 i	2.08 g	37.13 j	1.05 h
T7: BARI Tomato-17	50.4 f	6.43 d	52.43 f	5.35 d	68.60 f	2.23 ef
T8: BARI Tomato-18	61.1 b	8.87 b	99.01 b	6.59 ab	127.25 b	3.64 b
T9: BARI Tomato-19	56.71 c	8.53 b	72.06 c	6.13 ab	103.43 c	3.30 c
T10: BARI Tomato-15	49.61 g	5.43 e	50.25 g	4.95 de	65.34 g	2.08 f
CV (%)	0.59	6.78	0.59	6.67	0.79	3.76
LSD value (0.05)	0.53	0.79	0.72	0.59	1.13	0.15

Assessment of Fruits Diameter (cm), Weight (g) and Yield (kg) on Each Plant of Specific Tomato Cultivars

It was found that the T₁ cultivar had the largest fruit diameter (6.66 cm), while the T₆ cultivar had the smallest (2.08 cm). The T₆ cultivar weighed the least quantity of fruit (37.13 g), while the T₁ cultivar weighed the most (181.30 g). In terms of yield, T₁ cultivar produced the most (4.10 kg), while T₆ cultivar produced the least (1.05 kg). These parameters were decreased with the increasing intensity of TYLCV (Table IV). These outcomes were comparable to those of Hossain et al. [33], who found that TYLCV reduced fruit girth and production by 39.63%–85.44% and 55.21%–67.02%, respectively. According to the current study, the number of whiteflies, tomato variety, growth conditions, and viral infection all appeared to have varied effects on the yield-contributing characteristics. The same findings were noted by Ajlan et al. [34] and Olaniyi et al. [35].

Correlation Study among the Disease Intensity, Whitefly Association with Yield of Selected Tomato Varieties

From the correlation between disease incidence (%) and yield, regression analysis’s contribution (R² = 0.8642) showed that TYLCV infection would impact 86.42% of tomato yield (Fig. 4). From Fig. 5, it was clear that the data was well-fitted by the equation y = −0.101x + 6.8489, and the coefficient of correlation (R² = 0.9415) demonstrated that, contamination with TYLCV could reduce the tomato production by 94.15%. So, it can be inferred from this relationship that the disease incidence and severity of the selected tomato cultivars was inversely correlated with tomato yield. Almost similar results were reported by Alam et al. [36] and Rashid et al. [37]. However, the yield and whitefly population correlation revealed that TYLCV infection would impact 96.2% of yield (Fig. 6). This result is endorsed by the stated outcomes of Anik AH [38].

Fig. 4. Correlation between yield (kg) and disease incidence (%).

Fig. 5. Correlation between yield (kg) and disease severity (%).

Fig. 6. Correlation between yield (kg) and number of whiteflies.

Conclusion

The results derived from the molecular assessment using the PCR test were found to be nearly identical to PCR studies for detecting the TYLCV based on physiological parameters. So, PCR is the most reliable modern technique for detecting the TYLCV due to its simplicity, high robustness, and high specificity. According to the aforementioned results on the various parameters examined, BARI Tomato-5, BARI Tomato-18, and BARI Tomato-19 can be recommended as disease-resistant cultivars against TYLCV that exhibited a low correlation with whiteflies, a lower disease intensity levels, and a higher yield.